The wide use of energy-efficient district heating systems allows for decreased atmospheric pollution resulting from lower emissions. One of the ways to increase the efficiency of existing district heating systems, and a key element of new systems using renewable energy sources, is modern heat storage technology—the utilization of dispersed PCM heat accumulators. However, the use of different solutions and the inconsistency of selection methods make it difficult to compare the obtained results. Therefore, in this paper, using TRNSYS software, a standardization of the selection of dispersed PCM heat accumulators for cooperation with buildings in the DHS was proposed along with a Life Cycle Assessment. Life Cycle Assessment could be a good, versatile indicator for new developments in district heating systems. A new contribution to the research topic was the Life Cycle Assessment itself as well as the range of heat output of the substations up to 2000 kW and the development of nomograms an... [more]

Electric vehicles (EVs) are becoming popular due to their efficiency, eco-friendliness, and the increasing cost of fossil fuel. EVs support a variety of apps because they house powerful processors and allow for increased connectivity. This makes them an attractive target of stealthy cryptomining malware. Recent incidents demonstrate that both the EV and its communication model are vulnerable to cryptojacking attacks. The goal of this research is to explore the extent to which cryptojacking impacts EVs in terms of recharging and cost. We assert that while cryptojacking provides a financial advantage to attackers, it can severely degrade efficiency and cause battery loss. In this paper we present a simulation model for connected EVs, the cryptomining software, and the road infrastructure. A novel framework is proposed that incorporates these models and allows an objective quantification of the extent of this economic damage and the advantage to the attacker. Our results indicate that bat... [more]

The Vapor Compression Refrigeration System (VCRS) is one of the most critical systems in buildings typically used in Heating, Ventilation, and Air Conditioning (HVAC) systems in residential and industrial sections. Therefore, identifying their faults and evaluating their reliability are essential to ensure the required operations and performance in these systems. Various components and subsystems are included in the VCRS, which need to be analyzed for system reliability. This research’s objective is conducting a comprehensive system reliability analysis on the VCRS by focusing on fault identification and determining the fault impacts on these systems. A typical VCRS in an office building is selected for this research regarding this objective. The corresponding reliability data, including the probability distributions and parameters, are collected from references to perform the reliability evaluation on the components and subsystems of the VCRS. Then the optimum distribution parameters... [more]

Raw Jojoba oil was used in a direct-injection diesel engine without any engine modifications and compared with both diesel fuel and 50/50 raw Jojoba/diesel. The measured parameters included the rheological properties measured in the range of shear rate from 100 to 500 1/s. Distillation data were presented for raw Jojoba oil compared to diesel. The parameters included exhaust gas analysis, block vibration, sound noise, and the combustion pressure and its rise rate. Averaged pressure-crank angle, vibration, and its frequency spectrum and sound level were presented. Data also included brake power, specific fuel consumption, and exhaust temperatures for all fuels used. For Jojoba oil, the engine did not exhibit low power output or specific fuel consumption. Exhaust temperatures, smoke opacity, and NOx emissions were lower than diesel case. Noise for Jojoba was higher than diesel case. The engine block vibration was concentrated towards the low frequency range.

Increasing drilling speed and shortening the well construction period are the goals of the drilling field. The use of downhole speed-up tools has been noted for its advantages such as no additional cost, no change in drilling equipment and no impact on normal drilling operations. However, conventional downhole speed-up tools cannot meet the needs when the drilled formation contains hydrogen sulfide. Then, the technology test on increasing drilling speed by absorption and hydraulic supercharging of drill string in hydrogen sulfide formation was carried out in well Wanweiye1 (WWY1), Anhui Province, China. The results show that: firstly, the speed-up device by absorption and hydraulic supercharging of drill string can be used in the formation containing hydrogen sulfide, and can still perform normal drilling operations with a hydrogen sulfide concentration of 567 ppm; secondly, the speed-up technology by absorption and hydraulic supercharging of drill string has a significant speed-raisin... [more]

Shale reservoirs are characterized by extremely low porosity and permeability, poor connectivity, and high content of clay minerals. This leads to the reservoir being vulnerable to imbibition damage caused by foaming agent solutions during foam drainage gas recovery. It results in the decrease of reservoir permeability and the reduction of gas well production and ultimate recovery. Therefore, as the most commonly used foam drainage gas production, it is particularly important. This study is structured as follows. First, we analyze and evaluate the characteristics of shale reservoirs within the target area, and that of mineral composition and microscopic pore throat structures. Second, we study foaming agent types and two types are selected to be applied in subsequent sensitivity tests. Simultaneously, the nuclear magnetic resonance (NMR) method was used to study the microscopic characteristics of reservoir damage and imbibition damage of shale, caused by the impact of foaming agent sol... [more]

This article presents the characteristics of the heaps resulting from coal exploitation in terms of the possibility of their development for industrial facilities. The chances of soil improvement and the existing threats were indicated, emphasising the risk of self-ignition. The most effective technologies are dynamic or impulse compaction, which allows deep soil improvement and the obtaining of an appropriately rigid and load-bearing subsoil. The homogeneity of the soil’s mechanical properties that form the subsoil is also essential, which guarantees compliance with the serviceability limit state. A very important aspect of the investment process in the post-mining waste dumps is the risk of auto-ignition of the accumulated material. Considerations and analyses are presented on the example of the implementation of Panatonni service, warehouse, and production halls in Ruda Śląska. The performance of impulse compaction allowed for the safe construction of industrial halls. In particular... [more]

A simple semi-empirical gas-dynamic approach for measuring the instantaneous mass flow rate of gasification products of low-melting solid material (polypropylene) in a flow-through gas generator with ambient-temperature air as gasifying agent is proposed. The approach is validated experimentally in the direct-connect facility allowing for the short-term (~0.5 s) heating of incoming air up to ~1700 K by hydrogen injection and ignition or by pyrotechnic charge activation. The application of the proposed method for processing experimental data for 9 (of over 100) selected typical test fires showed that the time-averaged total yield of polypropylene gasification products varied from 43 to 120 g/s, while the air-to-gasification product mass ratio was 2.3−2.9. The results of all conducted experiments confirm the applicability of the proposed approach for determining the mass flow rate of gasification products. The universality of the proposed approach is confirmed by applying two different s... [more]

This study analyzes the instantaneous spatial energy density and Poynting vector in the WPT system and presents time-varying distributions and animations of this energy density and Poynting vector. First, the energy density is decoupled by two self-energy densities of each coil and the mutual energy density of the two coils. Result reveals how the energy is stored in the WPT system. Second, the Poynting vector is analyzed, and it is found that the power is transferred only in the last half period of the Poynting vector, not at every moment of the whole period. This instantaneous Poynting vector also possesses a characteristic that shows no power flow on the condition that the current phase difference equals zero. This finding is different from the energy density and indicates that the instantaneous Poynting vector can perfectly interpret how power is transferred in the WPT system. Finally, a simulation and an experiment were conducted to verify the correctness of the analysis. This stu... [more]

The COVID-19 pandemic has strongly affected the economic situation of many countries, which is worth considering not only globally but also in the context of specific industries. An asset that is particularly sensitive to negative economic changes is goodwill. The aim of this study is to assess the impact of the pandemic on the quality of financial disclosures concerning goodwill in consolidated financial statements of groups of chosen strategic sectors in Poland. We investigated the implications of the pandemic on the frequency and scale of goodwill impairment in relation to 23 companies listed on the Warsaw Stock Exchange from the Energy, Mining, and Fuel Index. We identified the research gap in this area. For the purposes of this study, two research hypotheses were formulated: (H1) during the COVID-19 pandemic, there has been a slight improvement in the quality of goodwill disclosures in the consolidated financial statements of groups in the energy, fuel, and mining sectors; (H2) Th... [more]

The article presents the results of research on the production of polymer-bitumen binder (PBB) based on mixtures of non-oxidized and oxidized petroleum products, namely high-viscosity tar, darkened vacuum distillate, and oxidized petroleum bitumen 70/100, obtained at technological installations of Limited Liability Partnership (LLP) “JV Caspi Bitum’’ and styrene-butadiene-styrene (SBS) block copolymer brand L 30-01A modifier in the presence of a stabilizer. The results obtained show that the introduction of the SBS modifier in the presence of a sulfur stabilizer improves the performance characteristics of PBB, such as elasticity, ductility, softening temperature, penetration, and brittleness temperature.

Ultrasonic spraying was used in a three-phase reactor to produce small droplets of triolein mixed with CaO as a solid catalyst at temperatures above the boiling point of methanol for enhancement of the transesterification of triolein. Droplets fell in the methanol countercurrent flow and were collected at the bottom of the reactor, followed by circulation to the ultrasonic spray system. The experimental parameters included triolein flow rates of 2.5−9.0 mL/min, reaction temperatures of 70−100 °C, and catalyst contents of 1.0−7.0 wt%. The methanol feed rate was set to be constant. The results suggested that the enhancement was successful after using the three-phase reactor by generating a high contact surface area for the droplets, which was a key factor for determining the performance. Comparing the results with conventional transesterification in the liquid phase using the same CaO at 60 °C, the three-phase reactor produced a methyl ester yield 2−5% higher during the 60 min trial peri... [more]

A study on the catalytic oxidation of heavy residual oil (HRO) was carried out. The thermodynamic parameters of components of HRO oxidation products were studied by pulsed nuclear magnetic resonance (NMR). A method for the quantitative assessment of thermodynamic parameters of HRO components and oxidized bitumen using pulsed NMR is presented. The relationship between NMR parameters and the viscosity of HRO and its oxidation products is established. The obtained results prove the possibility of using pulsed NMR as a flow-line method for rapid analysis of intermediates and products of the heavy residual oil oxidation.

This special issue is devoted to new developments in measurement technologies for upstream and downstream bioprocessing [...]

Non-Alcoholic Fatty Liver Disease (NAFLD) is caused by the accumulation of fat in over 5% of hepatocytes in the absence of alcohol consumption. NAFLD is considered the hepatic manifestation of metabolic syndrome (MS). Recently, an expert consensus suggested as more appropriate the term MAFLD (metabolic-associated fatty liver disease). Insulin resistance (IR) plays a key role in the development of NAFLD, as it causes an increase in hepatic lipogenesis and an inhibition of adipose tissue lipolysis. Beyond the imbalance of adipokine levels, the increase in the mass of visceral adipose tissue also determines an increase in free fatty acid (FFA) levels. In turn, an excess of FFA is able to determine IR through the inhibition of the post-receptor insulin signal. Adipocytes secrete chemokines, which are able to enroll macrophages inside the adipose tissue, responsible, in turn, for the increased levels of TNF-α. The latter, as well as resistin and other pro-inflammatory cytokines such as IL-6... [more]

Kenaf (Hibiscus Cannabinus) fibers have received significant attention for replacing the usage of synthetic fibers, especially glass fiber, in the fabrication of fiber-reinforced polymer (FRP) composites. The aim of this research was to study the change in wear behavior of kenaf-epoxy fiber composites by filling them with multiwall carbon nanotubes (MWCNT). In particular, the effect of untreated MWCNT (PMWCNT), acid-treated MWCNT (AMWCNT), and silane-treated MWCNT (SMWCNT) was studied, using three different MWCNT loadings, i.e., 0.5, 0.75, and 1 wt.%. The abrasive wear test was conducted to measure the wear properties of the composites. A thermal infrared camera was also used to measure the punctual contact temperature during the abrasive wear test, while the abraded surfaces were analyzed using the stereomicroscope. Starting from the considerable reduction of wear rate with the introduction of kenaf fibers, it was observed that PMWCNT provided some further, yet modest, reduction of we... [more]

A kinetic model is proposed to fit isothermal thermogravimetric data obtained from cellulose in an inert atmosphere at different temperatures. The method used here to evaluate the model involves two steps: (1) fitting of single time-derivative thermogravimetric curves (DTG) obtained at different temperatures versus time, and (2) fitting of the rate parameter values obtained at different temperatures versus temperature. The first step makes use of derivative of logistic functions. For the second step, the dependence of the rate factor on temperature is evaluated. That separation of the curve fitting from the analysis of the rate factor resulted to be very flexible since it proved to work for previous crystallization studies and now for thermal degradation of cellulose.

Sago hampas composed of a high percentage of polysaccharides (starch, cellulose and hemicellulose) that make it a suitable substrate for fermentation. However, the saccharification of sago hampas through the batch process is always hampered by its low sugar concentration due to the limitation of the substrate that can be loaded into the system. Increased substrate concentration in the system reduces the ability of enzyme action toward the substrate due to substrate saturation, which increases viscosity and causes inefficient mixing. Therefore, sequential-substrate feeding has been attempted in this study to increase the amount of substrate in the system by feeding the substrate at the selected intervals. At the same time, sequential-enzymes loading has been also evaluated to maximize the amount of enzymes loaded into the system. Results showed that this saccharification with sequential-substrate feeding and sequential-enzymes loading has elevated the solid loading up to 20% (w/v) and r... [more]

Intractable problems are challenging and not uncommon in Computer Science. The computing generation we are living in forces us to look for an alternative way of computing, as current computers are facing limitations when dealing with complex problems and bigger input data. Physics and Biology offer great alternatives to solve these problems that traditional computers cannot. Models like Quantum Computing and cell computing are emerging as possible solutions to the current problems the conventional computers are facing. This proposal describes an in vivo framework inspired by membrane computing and based on alternative computational frameworks that have been proven to be theoretically correct such as chemical reaction series. The abilities of a cell as a computational unit make this proposal a starting point in the creation of feasible potential frameworks to enhance the performance of applications in different disciplines such as Biology, BioMedicine, Computer networks, and Social Scie... [more]

The mechanical response and deformation mechanisms of TB17 titanium alloy were studied at room temperature by the split-Hopkinson pressure bar test. The ultimate compression strength increases from 1050 MPa to 1400 MPa, as the strain rate increases from 2000 s−1 to 2800 s−1. The adiabatic shear failure occurred at strain rate 2800 s−1. When the strain rate was 2000 s−1, only {10 9 3}β type II high index deformation twins, a small number of α” martensite, and interfacial ω phase were detected. When the strain rate was 2400 s−1 and above, multiple deformation mechanisms, including the primary {10 9 3}β type II high index deformation twins, secondary {332}β deformation twins, and α” martensite were identified. The deformation mechanism changes from primary deformation twins and α” martensite to multiple deformation mechanisms (primary and secondary deformation structure) with the increase of strain rates.

This study examined the literature on life cycle assessment on the ferromanganese alloy production route. The environmental impacts of raw material acquisition through the production of carbon reductants to the production of ferromanganese alloys were examined and compared. The transition from the current fossil fuel-based production to a more sustainable production route was reviewed. Besides the environmental impact, policy and socioeconomic impacts were considered due to evaluation course of differences in the production routes. Charcoal has the potential to substantially replace fossil fuel reductants in the upcoming decades. The environmental impact from current ferromanganese alloy production can be reduced by ≥20% by the charcoal produced in slow pyrolysis kilns, which can be further reduced by ≥50% for a sustainable production in high-efficient retorts. Certificated biomass can ensure a sustainable growth to avoid deforestation and acidification of the environment. Although gre... [more]

Manual generation of test cases and scenario screening processes, during field architecture concept development, may produce a limited number of solutions that do not necessarily lead to an optimal concept selection. For more complex subsea field architectures, which might include processing modules for enhancing pressure and thermal management for the production network, the number of configuration cases and scenarios to evaluate can be extremely large and time and resource-consuming to handle through conventional manual design processes. This paper explores the use of evolutionary algorithms (EA) to automate case generation, scenario screening, and optimization of decentralized subsea processing modules during field development. An evaluation of various genetic operators and evolution strategies was performed to compare their performance and suitability to the application. Based on the evaluation results, an EA using structural uniform crossover and a gradient plus boundary mutation... [more]

The absorption process of CO2 by ethanolamine solution is essentially a dynamic system, which is greatly affected by the power plant startup and flue gas load changes. Hence, studying the optimal control of the CO2 chemical capture process has always been an important part in academic fields. Model predictive control (MPC) is a very effective control strategy used for such process, but the most intractable problem is the lack of accurate and effective model. In this work, Aspen Plus and Aspen Plus Dynamics are used to establish the process of monoethanolamine (MEA) absorption of CO2 related models based on subspace identification. The nonlinear distribution of the system under steady-state operation is analyzed. Dynamic tests were carried out to understand the dynamic characteristics of the system under variable operating conditions. Systematic subspace identification on open-loop experimental data was performed. We designed a model predictive controller based on the identified model c... [more]

The heat transfer, friction factor, and collector efficiency are estimated experimentally for multi-walled carbon nanotubes+Fe3O4 hybrid nanofluid flows in a solar flat plate collector under thermosyphon circulation. The combined technique of in-situ growth and chemical coprecipitation was utilized to synthesize the multi-walled carbon nanotubes+Fe3O4 hybrid nanoparticles. The experiments were carried out at volume flow rates from 0.1 to 0.75 L/min and various concentrations from 0.05% to 0.3%. The viscosity and thermal conductivity of the hybrid nanofluids were experimentally measured at different temperatures and concentrations. Due to the improved thermophysical properties of the hybrid nanofluids, the collector achieved better thermal efficiency. Results show that the maximum thermal conductivity and viscosity enhancements are 28.46% and 50.4% at 0.3% volume concentration and 60 °C compared to water data. The Nusselt number, heat transfer coefficient, and friction factor are augmen... [more]

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA−PVS−Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA−PVS−Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01−0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses e... [more]