Browse
Record Types
Records with Type: Published Article
Showing records 14123 to 14147 of 43292. [First] Page: 1 562 563 564 565 566 567 568 569 570 Last
Analysis and Visualization of the Instantaneous Spatial Energy Density and Poynting Vector of the Wireless Power Transfer System
Jianwei Kang, Jie Lu, Deyu Zeng, Xiangyang Shi
March 28, 2023 (v1)
Subject: Other
Keywords: animation, electromagnetic energy density, Poynting vector, wireless power transfer
This study analyzes the instantaneous spatial energy density and Poynting vector in the WPT system and presents time-varying distributions and animations of this energy density and Poynting vector. First, the energy density is decoupled by two self-energy densities of each coil and the mutual energy density of the two coils. Result reveals how the energy is stored in the WPT system. Second, the Poynting vector is analyzed, and it is found that the power is transferred only in the last half period of the Poynting vector, not at every moment of the whole period. This instantaneous Poynting vector also possesses a characteristic that shows no power flow on the condition that the current phase difference equals zero. This finding is different from the energy density and indicates that the instantaneous Poynting vector can perfectly interpret how power is transferred in the WPT system. Finally, a simulation and an experiment were conducted to verify the correctness of the analysis. This stu... [more]
The Quality of Goodwill Disclosures and Impairment in the Financial Statements of Energy, Mining, and Fuel Sector Groups during the Pandemic Period—Evidence from Poland
Maciej Gierusz, Stanisław Hońko, Marzena Strojek-Filus, Katarzyna Świetla
March 28, 2023 (v1)
Keywords: disclosures of financial information, energy sector, fuel, goodwill, impairment of goodwill, mining, quality of financial statements
The COVID-19 pandemic has strongly affected the economic situation of many countries, which is worth considering not only globally but also in the context of specific industries. An asset that is particularly sensitive to negative economic changes is goodwill. The aim of this study is to assess the impact of the pandemic on the quality of financial disclosures concerning goodwill in consolidated financial statements of groups of chosen strategic sectors in Poland. We investigated the implications of the pandemic on the frequency and scale of goodwill impairment in relation to 23 companies listed on the Warsaw Stock Exchange from the Energy, Mining, and Fuel Index. We identified the research gap in this area. For the purposes of this study, two research hypotheses were formulated: (H1) during the COVID-19 pandemic, there has been a slight improvement in the quality of goodwill disclosures in the consolidated financial statements of groups in the energy, fuel, and mining sectors; (H2) Th... [more]
Preparation of Polymer Bitumen Binder in the Presence of a Stabilizer
Yerzhan Imanbayev, Anar Akkenzheyeva, Akkenzhe Bussurmanova, Akmaral Serikbayeva, Assiya Boranbayeva
March 28, 2023 (v1)
Subject: Materials
Keywords: bitumen, ductility, elasticity, modifier, penetration, plasticity, styrene-butadiene-styrene block copolymer, tar
The article presents the results of research on the production of polymer-bitumen binder (PBB) based on mixtures of non-oxidized and oxidized petroleum products, namely high-viscosity tar, darkened vacuum distillate, and oxidized petroleum bitumen 70/100, obtained at technological installations of Limited Liability Partnership (LLP) “JV Caspi Bitum’’ and styrene-butadiene-styrene (SBS) block copolymer brand L 30-01A modifier in the presence of a stabilizer. The results obtained show that the introduction of the SBS modifier in the presence of a sulfur stabilizer improves the performance characteristics of PBB, such as elasticity, ductility, softening temperature, penetration, and brittleness temperature.
Transesterification Using Ultrasonic Spray of Triolein Containing CaO Particles into Methanol Vapor in a 3-Phase Reactor
Ravisut Vitidsant, Satoshi Kodama, Hidetoshi Sekiguchi
March 28, 2023 (v1)
Keywords: CaO, methanol vapor, three-phase reactor, transesterification, triolein, ultrasonic spraying
Ultrasonic spraying was used in a three-phase reactor to produce small droplets of triolein mixed with CaO as a solid catalyst at temperatures above the boiling point of methanol for enhancement of the transesterification of triolein. Droplets fell in the methanol countercurrent flow and were collected at the bottom of the reactor, followed by circulation to the ultrasonic spray system. The experimental parameters included triolein flow rates of 2.5−9.0 mL/min, reaction temperatures of 70−100 °C, and catalyst contents of 1.0−7.0 wt%. The methanol feed rate was set to be constant. The results suggested that the enhancement was successful after using the three-phase reactor by generating a high contact surface area for the droplets, which was a key factor for determining the performance. Comparing the results with conventional transesterification in the liquid phase using the same CaO at 60 °C, the three-phase reactor produced a methyl ester yield 2−5% higher during the 60 min trial peri... [more]
Catalytic Oxidation of Heavy Residual Oil by Pulsed Nuclear Magnetic Resonance
Alexey V. Vakhin, Elena I. Cherkasova, Aliya G. Safiulina, Galiya G. Islamova, Sergey M. Petrov, Natalya Yu. Bashkirtseva
March 28, 2023 (v1)
Subject: Materials
Keywords: catalytic oxidation, heavy residual oil, nuclear magnetic resonance, oxidized bitumen, thermodynamic parameters
A study on the catalytic oxidation of heavy residual oil (HRO) was carried out. The thermodynamic parameters of components of HRO oxidation products were studied by pulsed nuclear magnetic resonance (NMR). A method for the quantitative assessment of thermodynamic parameters of HRO components and oxidized bitumen using pulsed NMR is presented. The relationship between NMR parameters and the viscosity of HRO and its oxidation products is established. The obtained results prove the possibility of using pulsed NMR as a flow-line method for rapid analysis of intermediates and products of the heavy residual oil oxidation.
Measurement Technologies for Upstream and Downstream Bioprocessing
Carl-Fredrik Mandenius
March 28, 2023 (v1)
This special issue is devoted to new developments in measurement technologies for upstream and downstream bioprocessing [...]
Non-Alcoholic Fatty Liver Disease: From Pathogenesis to Clinical Impact
Alfredo Caturano, Carlo Acierno, Riccardo Nevola, Pia Clara Pafundi, Raffaele Galiero, Luca Rinaldi, Teresa Salvatore, Luigi Elio Adinolfi, Ferdinando Carlo Sasso
March 28, 2023 (v1)
Subject: Biosystems
Keywords: CV risk, cytokines, insulin resistance, metabolic syndrome, NAFLD
Non-Alcoholic Fatty Liver Disease (NAFLD) is caused by the accumulation of fat in over 5% of hepatocytes in the absence of alcohol consumption. NAFLD is considered the hepatic manifestation of metabolic syndrome (MS). Recently, an expert consensus suggested as more appropriate the term MAFLD (metabolic-associated fatty liver disease). Insulin resistance (IR) plays a key role in the development of NAFLD, as it causes an increase in hepatic lipogenesis and an inhibition of adipose tissue lipolysis. Beyond the imbalance of adipokine levels, the increase in the mass of visceral adipose tissue also determines an increase in free fatty acid (FFA) levels. In turn, an excess of FFA is able to determine IR through the inhibition of the post-receptor insulin signal. Adipocytes secrete chemokines, which are able to enroll macrophages inside the adipose tissue, responsible, in turn, for the increased levels of TNF-α. The latter, as well as resistin and other pro-inflammatory cytokines such as IL-6... [more]
Abrasive Wear Behavior of CNT-Filled Unidirectional Kenaf−Epoxy Composites
Napisah Sapiai, Aidah Jumahat, Mohammad Jawaid, Carlo Santulli
March 28, 2023 (v1)
Subject: Materials
Keywords: abrasive wear, acid treated, kenaf composites, multiwall carbon nanotubes (MWCNT), silane treated
Kenaf (Hibiscus Cannabinus) fibers have received significant attention for replacing the usage of synthetic fibers, especially glass fiber, in the fabrication of fiber-reinforced polymer (FRP) composites. The aim of this research was to study the change in wear behavior of kenaf-epoxy fiber composites by filling them with multiwall carbon nanotubes (MWCNT). In particular, the effect of untreated MWCNT (PMWCNT), acid-treated MWCNT (AMWCNT), and silane-treated MWCNT (SMWCNT) was studied, using three different MWCNT loadings, i.e., 0.5, 0.75, and 1 wt.%. The abrasive wear test was conducted to measure the wear properties of the composites. A thermal infrared camera was also used to measure the punctual contact temperature during the abrasive wear test, while the abraded surfaces were analyzed using the stereomicroscope. Starting from the considerable reduction of wear rate with the introduction of kenaf fibers, it was observed that PMWCNT provided some further, yet modest, reduction of we... [more]
A Logistic Approach for Kinetics of Isothermal Pyrolysis of Cellulose
Jorge López-Beceiro, Ana María Díaz-Díaz, Ana Álvarez-García, Javier Tarrío-Saavedra, Salvador Naya, Ramón Artiaga
March 28, 2023 (v1)
Keywords: cellulose, degradation, isothermal, kinetics, pyrolysis
A kinetic model is proposed to fit isothermal thermogravimetric data obtained from cellulose in an inert atmosphere at different temperatures. The method used here to evaluate the model involves two steps: (1) fitting of single time-derivative thermogravimetric curves (DTG) obtained at different temperatures versus time, and (2) fitting of the rate parameter values obtained at different temperatures versus temperature. The first step makes use of derivative of logistic functions. For the second step, the dependence of the rate factor on temperature is evaluated. That separation of the curve fitting from the analysis of the rate factor resulted to be very flexible since it proved to work for previous crystallization studies and now for thermal degradation of cellulose.
Enzymatic Saccharification with Sequential-Substrate Feeding and Sequential-Enzymes Loading to Enhance Fermentable Sugar Production from Sago Hampas
Nurul Haziqah Alias, Suraini Abd-Aziz, Lai Yee Phang, Mohamad Faizal Ibrahim
March 28, 2023 (v1)
Keywords: amylase, Biomass, cellulase, saccharification, sago hampas, substrate feeding
Sago hampas composed of a high percentage of polysaccharides (starch, cellulose and hemicellulose) that make it a suitable substrate for fermentation. However, the saccharification of sago hampas through the batch process is always hampered by its low sugar concentration due to the limitation of the substrate that can be loaded into the system. Increased substrate concentration in the system reduces the ability of enzyme action toward the substrate due to substrate saturation, which increases viscosity and causes inefficient mixing. Therefore, sequential-substrate feeding has been attempted in this study to increase the amount of substrate in the system by feeding the substrate at the selected intervals. At the same time, sequential-enzymes loading has been also evaluated to maximize the amount of enzymes loaded into the system. Results showed that this saccharification with sequential-substrate feeding and sequential-enzymes loading has elevated the solid loading up to 20% (w/v) and r... [more]
An In Vivo Proposal of Cell Computing Inspired by Membrane Computing
Alberto Arteta Albert, Ernesto Díaz-Flores, Luis Fernando de Mingo López, Nuria Gómez Blas
March 28, 2023 (v1)
Keywords: bioinformatics, membrane computing, unconventional computing
Intractable problems are challenging and not uncommon in Computer Science. The computing generation we are living in forces us to look for an alternative way of computing, as current computers are facing limitations when dealing with complex problems and bigger input data. Physics and Biology offer great alternatives to solve these problems that traditional computers cannot. Models like Quantum Computing and cell computing are emerging as possible solutions to the current problems the conventional computers are facing. This proposal describes an in vivo framework inspired by membrane computing and based on alternative computational frameworks that have been proven to be theoretically correct such as chemical reaction series. The abilities of a cell as a computational unit make this proposal a starting point in the creation of feasible potential frameworks to enhance the performance of applications in different disciplines such as Biology, BioMedicine, Computer networks, and Social Scie... [more]
Mechanical Response and Deformation Mechanisms of TB17 Titanium Alloy at High Strain Rates
Xinchi Chen, Xiaoyong Zhang, Chao Chen, Kechao Zhou
March 28, 2023 (v1)
Subject: Materials
Keywords: deformation mechanism, interfacial ω phase, martensite, near-β titanium alloy, SHPB, twins
The mechanical response and deformation mechanisms of TB17 titanium alloy were studied at room temperature by the split-Hopkinson pressure bar test. The ultimate compression strength increases from 1050 MPa to 1400 MPa, as the strain rate increases from 2000 s−1 to 2800 s−1. The adiabatic shear failure occurred at strain rate 2800 s−1. When the strain rate was 2000 s−1, only {10 9 3}β type II high index deformation twins, a small number of α” martensite, and interfacial ω phase were detected. When the strain rate was 2400 s−1 and above, multiple deformation mechanisms, including the primary {10 9 3}β type II high index deformation twins, secondary {332}β deformation twins, and α” martensite were identified. The deformation mechanism changes from primary deformation twins and α” martensite to multiple deformation mechanisms (primary and secondary deformation structure) with the increase of strain rates.
Life Cycle Assessment of Renewable Reductants in the Ferromanganese Alloy Production: A Review
Gerrit Ralf Surup, Anna Trubetskaya, Merete Tangstad
March 28, 2023 (v1)
Subject: Environment
Keywords: charcoal, life cycle assessment, metallurgical coke, mining, sustainable biomass growth
This study examined the literature on life cycle assessment on the ferromanganese alloy production route. The environmental impacts of raw material acquisition through the production of carbon reductants to the production of ferromanganese alloys were examined and compared. The transition from the current fossil fuel-based production to a more sustainable production route was reviewed. Besides the environmental impact, policy and socioeconomic impacts were considered due to evaluation course of differences in the production routes. Charcoal has the potential to substantially replace fossil fuel reductants in the upcoming decades. The environmental impact from current ferromanganese alloy production can be reduced by ≥20% by the charcoal produced in slow pyrolysis kilns, which can be further reduced by ≥50% for a sustainable production in high-efficient retorts. Certificated biomass can ensure a sustainable growth to avoid deforestation and acidification of the environment. Although gre... [more]
Evolutionary Algorithm to Support Field Architecture Scenario Screening Automation and Optimization Using Decentralized Subsea Processing Modules
Mariana J. C. Díaz Arias, Allyne M. dos Santos, Edmary Altamiranda
March 28, 2023 (v1)
Subject: Optimization
Keywords: decentralized subsea processing, evolutionary algorithms, field architecture concepts
Manual generation of test cases and scenario screening processes, during field architecture concept development, may produce a limited number of solutions that do not necessarily lead to an optimal concept selection. For more complex subsea field architectures, which might include processing modules for enhancing pressure and thermal management for the production network, the number of configuration cases and scenarios to evaluate can be extremely large and time and resource-consuming to handle through conventional manual design processes. This paper explores the use of evolutionary algorithms (EA) to automate case generation, scenario screening, and optimization of decentralized subsea processing modules during field development. An evaluation of various genetic operators and evolution strategies was performed to compare their performance and suitability to the application. Based on the evaluation results, an EA using structural uniform crossover and a gradient plus boundary mutation... [more]
Model Predictive Control for the Process of MEA Absorption of CO2 Based on the Data Identification Model
Qianrong Li, Wenzhao Zhang, Yuwei Qin, Aimin An
March 28, 2023 (v1)
Keywords: Aspen Plus dynamics, Model Predictive Control, post-combustion capture CO2 system, subspace identification
The absorption process of CO2 by ethanolamine solution is essentially a dynamic system, which is greatly affected by the power plant startup and flue gas load changes. Hence, studying the optimal control of the CO2 chemical capture process has always been an important part in academic fields. Model predictive control (MPC) is a very effective control strategy used for such process, but the most intractable problem is the lack of accurate and effective model. In this work, Aspen Plus and Aspen Plus Dynamics are used to establish the process of monoethanolamine (MEA) absorption of CO2 related models based on subspace identification. The nonlinear distribution of the system under steady-state operation is analyzed. Dynamic tests were carried out to understand the dynamic characteristics of the system under variable operating conditions. Systematic subspace identification on open-loop experimental data was performed. We designed a model predictive controller based on the identified model c... [more]
Thermal Efficiency, Heat Transfer, and Friction Factor Analyses of MWCNT + Fe3O4/Water Hybrid Nanofluids in a Solar Flat Plate Collector under Thermosyphon Condition
Bahaa Saleh, Lingala Syam Sundar
March 28, 2023 (v1)
Subject: Materials
Keywords: flat plate collector, friction factor, heat transfer, hybrid nanofluids, thermosyphon
The heat transfer, friction factor, and collector efficiency are estimated experimentally for multi-walled carbon nanotubes+Fe3O4 hybrid nanofluid flows in a solar flat plate collector under thermosyphon circulation. The combined technique of in-situ growth and chemical coprecipitation was utilized to synthesize the multi-walled carbon nanotubes+Fe3O4 hybrid nanoparticles. The experiments were carried out at volume flow rates from 0.1 to 0.75 L/min and various concentrations from 0.05% to 0.3%. The viscosity and thermal conductivity of the hybrid nanofluids were experimentally measured at different temperatures and concentrations. Due to the improved thermophysical properties of the hybrid nanofluids, the collector achieved better thermal efficiency. Results show that the maximum thermal conductivity and viscosity enhancements are 28.46% and 50.4% at 0.3% volume concentration and 60 °C compared to water data. The Nusselt number, heat transfer coefficient, and friction factor are augmen... [more]
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)−Silver Nanocomposite
Mawethu Pascoe Bilibana, Usisipho Feleni, Avril Rae Williams, Emmanuel Iwuoha
March 28, 2023 (v1)
Subject: Materials
Keywords: electrochemical aptasensor, microcystin-LR, poly(2,5-dimethoxyaniline), silver nanoparticles, small-angle X-ray scattering spectroscopy (SAXS)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA−PVS−Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA−PVS−Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01−0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses e... [more]
Novel Methods Using an Arthrobacter sp. to Create Anaerobic Conditions for Biobutanol Production from Sweet Sorghum Juice by Clostridium beijerinckii
Chalida Daengbussadee, Lakkana Laopaiboon, Anuphon Kaewmaneewat, Likit Sirisantimethakom, Pattana Laopaiboon
March 28, 2023 (v1)
Keywords: ABE fermentation, anaerobic condition creation, Arthrobacter sp., biobutanol, Clostridium beijerinckii, sodium dithionite
Biobutanol can be produced by Clostridia via an acetone−butanol−ethanol (ABE) fermentation under strictly anaerobic conditions. Oxygen-free nitrogen (OFN) gas is typically used to create anaerobic conditions for ABE fermentations. However, this method is not appropriate for large-scale fermentations as it is quite costly. The aim of this work was to study the feasibility of butanol production from sweet sorghum juice (SSJ) by Clostridium beijerinckii TISTR 1461 using various methods to create anaerobic conditions, i.e., growth of a strictly aerobic bacterium, an Arthrobacter sp., under different conditions and a chemical method using sodium dithionite (SDTN) to consume residual oxygen. SSJ containing 60 g/L of total sugar supplemented with 1.27 g/L of (NH4)2SO4 was used as a substrate for butanol production. The results showed that 0.25 mM SDTN could create anaerobic conditions, but in this case, C.beijerinckii TISTR 1461 could produce butanol at a concentration (PB) of only 8.51 g/L w... [more]
Culturing of Melanocytes from the Equine Hair Follicle Outer Root Sheath
Hanluo Li, Jule Kristin Michler, Alexander Bartella, Anna Katharina Sander, Sebastian Gaus, Sebastian Hahnel, Rüdiger Zimmerer, Jan-Christoph Simon, Vuk Savkovic, Bernd Lethaus
March 28, 2023 (v1)
Subject: Biosystems
Keywords: equine hair follicle, horse, melanocytes, outer root sheath
Hair follicles harbor a heterogeneous regenerative cell pool and represent a putative low-to-non-invasively available source of stem cells. We previously reported a technology for culturing human melanocytes from the hair follicle outer root sheath (ORS) for autologous pigmentation of tissue engineered skin equivalents. This study translated the ORS technology to horses. We de-veloped a culture of equine melanocytes from the ORS (eMORS) from equine forelock hair follicles cultured by means of an analogue human hair follicle-based in vitro methodology. The procedure was adjusted to equine physiology by addition of equine serum to the culture medium. The hair follicles were isolated by macerating forelock skin rests, enzymatically digested and subjected to air-medium-interface cultivation method. The procedure resulted in differentiated equine melanocytes, which exhibited typical morphology, presence of melanosomes, expression of cytoskeleton proteins vimentin, α-SMA, Sox2, S100ß and tyr... [more]
Evaluation of Dissolution Profiles of a Newly Developed Solid Oral Immediate-Release Formula Containing Alpha-Lipoic Acid
Anca Lucia Pop, Simona Crișan, Maria Bârcă, Anne-Marie Ciobanu, Valentin Nicolae Varlas, Coriolan Pop, Mariana-Ana Pali, Dumitru Cauni, Emma Adriana Ozon, Denisa Udeanu, Simona Trifu, Bogdana Adriana Năsui
March 28, 2023 (v1)
Keywords: alpha-lipoic acid, dissolution profiles, dissolution rate, food supplements, formulation effect, quality target product profile, tablets
Alpha-lipoic acid (ALA, thioctic acid), a naturally-occurring essential dithiol compound, has become a common ingredient in many pharmaceutical and food supplement products (FSP), used in oxidative stress-dependent pathologies; oral bioavailability of ALA is limited by pharmacokinetic particularities that reduce its therapeutic efficacy-reduced solubility, lack of gastric stability and hepatic degradation, doubled by formulation hinders. The objectives were to develop a solid oral 600 mg ALA FSP to obtain an optimal pharmaceutical profile compared to a reference listed drug (RLD) with a similarity factor f2 50. A comparative dissolution study was performed; an HPLC method was used for ALA quantification. After planning combinatory simulations (formulation stage), two prototype formulas (#1 and #2) were manufactured and further optimized by adjusting ALA physical characteristics and the excipients quantities (#3 and #4) in order to achieve the Quality Target Product Profile. A misshapen... [more]
Extra-Heavy Crude Oil Viscosity Reduction Using and Reusing Magnetic Copper Ferrite Nanospheres
Lucía Mateus, Esteban A. Taborda, Carlos Moreno-Castilla, María Victoria López-Ramón, Camilo A. Franco, Farid B. Cortés
March 28, 2023 (v1)
Subject: Materials
Keywords: extra-heavy crude oil, magnetic copper ferrite nanospheres, nanomaterial reuse, viscosity reduction
The main objective of this study is the synthesis, use, and reuse of magnetic copper ferrite nanospheres (CFNS) for extra-heavy oil viscosity reduction. The CFNS were synthesized using a solvothermal method resulting in mean particle size of 150 nm. Interactions of CFNS with the crude oil were evaluated through asphaltene adsorption isotherms, as well as static and dynamic rheology measurements for two cycles at 25 °C. Adsorption and desorption experiments corroborated that most of the asphaltenes adsorbed can be removed for nanoparticle reuse. During the rheology tests, nanoparticles were evaluated in the first cycle at different concentrations from 300 to 1500 mg/L, leading to the highest degree of viscosity reduction of 18% at 500 mg/L. SiO2 nanoparticles were evaluated for comparison issues, obtaining similar results regarding the viscosity reduction. After measurements, the CFNS were removed with a magnet, washed with toluene, and further dried for the second cycle of viscosity re... [more]
Hemicellulosic Bioethanol Production from Fast-Growing Paulownia Biomass
Elena Domínguez, Pablo G. del Río, Aloia Romaní, Gil Garrote, Lucília Domingues
March 28, 2023 (v1)
Keywords: fast-growing species, hemicellulosic ethanol, industrial yeast, inhibitors, Saccharomyces cerevisiae, Scheffersomyces stipitis, xylose fermentation
In order to exploit a fast-growing Paulownia hardwood as an energy crop, a xylose-enriched hydrolysate was obtained in this work to increase the ethanol concentration using the hemicellulosic fraction, besides the already widely studied cellulosic fraction. For that, Paulownia elongata x fortunei was submitted to autohydrolysis treatment (210 °C or S0 of 4.08) for the xylan solubilization, mainly as xylooligosaccharides. Afterwards, sequential stages of acid hydrolysis, concentration, and detoxification were evaluated to obtain fermentable sugars. Thus, detoxified and non-detoxified hydrolysates (diluted or not) were fermented for ethanol production using a natural xylose-consuming yeast, Scheffersomyces stipitis CECT 1922, and an industrial Saccharomyces cerevisiae MEC1133 strain, metabolic engineered strain with the xylose reductase/xylitol dehydrogenase pathway. Results from fermentation assays showed that the engineered S. cerevisiae strain produced up to 14.2 g/L of ethanol (corre... [more]
Thermal Oxidative Stability of Biodiesel/Petrodiesel Blends by Pressurized Differential Scanning Calorimetry and Its Calculated Cetane Index
Jilliano B. Silva, Josue S. Almeida, Rodrigo V. Barbosa, Glauber J. T. Fernandes, Ana C. F. Coriolano, Valter J. Fernandes Jr, Antonio S. Araujo
March 28, 2023 (v1)
Keywords: biodiesel/petrodiesel blends, Calculated Cetane Index (CCI), thermal-oxidative stability
Diesel fuel mixtures with high concentrations of biodiesel have been investigated to analyze the technical feasibility of their use in diesel cycle engines regarding thermal and oxidative properties. The results of combined techniques of oxidative stability, high Pressurized Differential Scanning Calorimetry (P-DSC), Calculated Cetane Index (CCI), and calorific power were used to verify the effect of the thermal-oxidative stability as a function of the percentage of biodiesel in the mixtures. The obtained results evidenced that the thermal and oxidative stability decreased with the addition of biodiesel from 50 to 5% v/v. Low stability fuels require rapid use as the oxidation compounds degrade the product and impair vehicle performance, as well as lead to corrosion and clogging problems in various mechanical systems.
Towards Autonomous Operation by Advanced Process Control—Process Analytical Technology for Continuous Biologics Antibody Manufacturing
Heribert Helgers, Axel Schmidt, Lara Julia Lohmann, Florian Lukas Vetter, Alex Juckers, Christoph Jensch, Mourad Mouellef, Steffen Zobel-Roos, Jochen Strube
March 28, 2023 (v1)
Subject: Biosystems
Keywords: attenuated total reflection fourier-transformed infrared spectroscopy (ATR-FTIR), chemometrics, Chinese hamster ovary (CHO), continuous manufacturing, digital twin, diode array detector, fluorescence, monoclonal antibody (mAb), multivariate data analysis, process analytical technology (PAT), quality by design (QbD), raman spectroscopy, real time release testing (RTRT)
Continuous manufacturing opens up new operation windows with improved product quality in contrast to documented lot deviations in batch or fed-batch operations. A more sophisticated process control strategy is needed to adjust operation parameters and keep product quality constant during long-term operations. In the present study, the applicability of a combination of spectroscopic methods was evaluated to enable Advanced Process Control (APC) in continuous manufacturing by Process Analytical Technology (PAT). In upstream processing (USP) and aqueous two-phase extraction (ATPE), Raman-, Fourier-transformed infrared (FTIR), fluorescence- and ultraviolet/visible- (UV/Vis) spectroscopy have been successfully applied for titer and purity prediction. Raman spectroscopy was the most versatile and robust method in USP, ATPE, and precipitation and is therefore recommended as primary PAT. In later process stages, the combination of UV/Vis and fluorescence spectroscopy was able to overcome diffi... [more]
Numerical Study on Unsteady Pressure Distribution on Bulk Carrier in Head Waves with Forward Speed
Kyung-Kyu Yang, Beom-Soo Kim, Yonghwan Kim, Masashi Kashiwagi, Hidetsugu Iwashita
March 28, 2023 (v1)
Keywords: added resistance, Cartesian-grid method, Rankine panel method, seakeeping analysis, unsteady hull pressure
This study deals with wave-induced unsteady pressure on a ship moving with a constant forward speed in regular head waves. Two different numerical methods are applied to solve wave−ship interaction problems: a Rankine panel method which adopts velocity potential, and a Cartesian-grid method which solves the momentum and mass conservation equations under the assumption of inviscid and incompressible fluids. Before comparing l1ocal pressure distributions, the computational methods are validated for global quantities, such as ship motion responses and added resistance, by comparison with available experimental data. Then, the computational results and experimental data are compared for hydrodynamic pressure, particularly focusing on the magnitude of the first-harmonic component in different sections and vertical locations. Furthermore, the Cartesian-grid method is used to simulate the various wave-amplitude conditions, and the characteristics of the zeroth-, first-, and second-harmonic co... [more]
Showing records 14123 to 14147 of 43292. [First] Page: 1 562 563 564 565 566 567 568 569 570 Last
(0.74 seconds)
[Show List of Record Types]

[0.75 s]