This study analyzes the instantaneous spatial energy density and Poynting vector in the WPT system and presents time-varying distributions and animations of this energy density and Poynting vector. First, the energy density is decoupled by two self-energy densities of each coil and the mutual energy density of the two coils. Result reveals how the energy is stored in the WPT system. Second, the Poynting vector is analyzed, and it is found that the power is transferred only in the last half period of the Poynting vector, not at every moment of the whole period. This instantaneous Poynting vector also possesses a characteristic that shows no power flow on the condition that the current phase difference equals zero. This finding is different from the energy density and indicates that the instantaneous Poynting vector can perfectly interpret how power is transferred in the WPT system. Finally, a simulation and an experiment were conducted to verify the correctness of the analysis. This stu... [more]

The COVID-19 pandemic has strongly affected the economic situation of many countries, which is worth considering not only globally but also in the context of specific industries. An asset that is particularly sensitive to negative economic changes is goodwill. The aim of this study is to assess the impact of the pandemic on the quality of financial disclosures concerning goodwill in consolidated financial statements of groups of chosen strategic sectors in Poland. We investigated the implications of the pandemic on the frequency and scale of goodwill impairment in relation to 23 companies listed on the Warsaw Stock Exchange from the Energy, Mining, and Fuel Index. We identified the research gap in this area. For the purposes of this study, two research hypotheses were formulated: (H1) during the COVID-19 pandemic, there has been a slight improvement in the quality of goodwill disclosures in the consolidated financial statements of groups in the energy, fuel, and mining sectors; (H2) Th... [more]

The article presents the results of research on the production of polymer-bitumen binder (PBB) based on mixtures of non-oxidized and oxidized petroleum products, namely high-viscosity tar, darkened vacuum distillate, and oxidized petroleum bitumen 70/100, obtained at technological installations of Limited Liability Partnership (LLP) “JV Caspi Bitum’’ and styrene-butadiene-styrene (SBS) block copolymer brand L 30-01A modifier in the presence of a stabilizer. The results obtained show that the introduction of the SBS modifier in the presence of a sulfur stabilizer improves the performance characteristics of PBB, such as elasticity, ductility, softening temperature, penetration, and brittleness temperature.

Ultrasonic spraying was used in a three-phase reactor to produce small droplets of triolein mixed with CaO as a solid catalyst at temperatures above the boiling point of methanol for enhancement of the transesterification of triolein. Droplets fell in the methanol countercurrent flow and were collected at the bottom of the reactor, followed by circulation to the ultrasonic spray system. The experimental parameters included triolein flow rates of 2.5−9.0 mL/min, reaction temperatures of 70−100 °C, and catalyst contents of 1.0−7.0 wt%. The methanol feed rate was set to be constant. The results suggested that the enhancement was successful after using the three-phase reactor by generating a high contact surface area for the droplets, which was a key factor for determining the performance. Comparing the results with conventional transesterification in the liquid phase using the same CaO at 60 °C, the three-phase reactor produced a methyl ester yield 2−5% higher during the 60 min trial peri... [more]

A study on the catalytic oxidation of heavy residual oil (HRO) was carried out. The thermodynamic parameters of components of HRO oxidation products were studied by pulsed nuclear magnetic resonance (NMR). A method for the quantitative assessment of thermodynamic parameters of HRO components and oxidized bitumen using pulsed NMR is presented. The relationship between NMR parameters and the viscosity of HRO and its oxidation products is established. The obtained results prove the possibility of using pulsed NMR as a flow-line method for rapid analysis of intermediates and products of the heavy residual oil oxidation.

This special issue is devoted to new developments in measurement technologies for upstream and downstream bioprocessing [...]

Non-Alcoholic Fatty Liver Disease (NAFLD) is caused by the accumulation of fat in over 5% of hepatocytes in the absence of alcohol consumption. NAFLD is considered the hepatic manifestation of metabolic syndrome (MS). Recently, an expert consensus suggested as more appropriate the term MAFLD (metabolic-associated fatty liver disease). Insulin resistance (IR) plays a key role in the development of NAFLD, as it causes an increase in hepatic lipogenesis and an inhibition of adipose tissue lipolysis. Beyond the imbalance of adipokine levels, the increase in the mass of visceral adipose tissue also determines an increase in free fatty acid (FFA) levels. In turn, an excess of FFA is able to determine IR through the inhibition of the post-receptor insulin signal. Adipocytes secrete chemokines, which are able to enroll macrophages inside the adipose tissue, responsible, in turn, for the increased levels of TNF-α. The latter, as well as resistin and other pro-inflammatory cytokines such as IL-6... [more]

Kenaf (Hibiscus Cannabinus) fibers have received significant attention for replacing the usage of synthetic fibers, especially glass fiber, in the fabrication of fiber-reinforced polymer (FRP) composites. The aim of this research was to study the change in wear behavior of kenaf-epoxy fiber composites by filling them with multiwall carbon nanotubes (MWCNT). In particular, the effect of untreated MWCNT (PMWCNT), acid-treated MWCNT (AMWCNT), and silane-treated MWCNT (SMWCNT) was studied, using three different MWCNT loadings, i.e., 0.5, 0.75, and 1 wt.%. The abrasive wear test was conducted to measure the wear properties of the composites. A thermal infrared camera was also used to measure the punctual contact temperature during the abrasive wear test, while the abraded surfaces were analyzed using the stereomicroscope. Starting from the considerable reduction of wear rate with the introduction of kenaf fibers, it was observed that PMWCNT provided some further, yet modest, reduction of we... [more]

A kinetic model is proposed to fit isothermal thermogravimetric data obtained from cellulose in an inert atmosphere at different temperatures. The method used here to evaluate the model involves two steps: (1) fitting of single time-derivative thermogravimetric curves (DTG) obtained at different temperatures versus time, and (2) fitting of the rate parameter values obtained at different temperatures versus temperature. The first step makes use of derivative of logistic functions. For the second step, the dependence of the rate factor on temperature is evaluated. That separation of the curve fitting from the analysis of the rate factor resulted to be very flexible since it proved to work for previous crystallization studies and now for thermal degradation of cellulose.

Sago hampas composed of a high percentage of polysaccharides (starch, cellulose and hemicellulose) that make it a suitable substrate for fermentation. However, the saccharification of sago hampas through the batch process is always hampered by its low sugar concentration due to the limitation of the substrate that can be loaded into the system. Increased substrate concentration in the system reduces the ability of enzyme action toward the substrate due to substrate saturation, which increases viscosity and causes inefficient mixing. Therefore, sequential-substrate feeding has been attempted in this study to increase the amount of substrate in the system by feeding the substrate at the selected intervals. At the same time, sequential-enzymes loading has been also evaluated to maximize the amount of enzymes loaded into the system. Results showed that this saccharification with sequential-substrate feeding and sequential-enzymes loading has elevated the solid loading up to 20% (w/v) and r... [more]

Intractable problems are challenging and not uncommon in Computer Science. The computing generation we are living in forces us to look for an alternative way of computing, as current computers are facing limitations when dealing with complex problems and bigger input data. Physics and Biology offer great alternatives to solve these problems that traditional computers cannot. Models like Quantum Computing and cell computing are emerging as possible solutions to the current problems the conventional computers are facing. This proposal describes an in vivo framework inspired by membrane computing and based on alternative computational frameworks that have been proven to be theoretically correct such as chemical reaction series. The abilities of a cell as a computational unit make this proposal a starting point in the creation of feasible potential frameworks to enhance the performance of applications in different disciplines such as Biology, BioMedicine, Computer networks, and Social Scie... [more]

The mechanical response and deformation mechanisms of TB17 titanium alloy were studied at room temperature by the split-Hopkinson pressure bar test. The ultimate compression strength increases from 1050 MPa to 1400 MPa, as the strain rate increases from 2000 s−1 to 2800 s−1. The adiabatic shear failure occurred at strain rate 2800 s−1. When the strain rate was 2000 s−1, only {10 9 3}β type II high index deformation twins, a small number of α” martensite, and interfacial ω phase were detected. When the strain rate was 2400 s−1 and above, multiple deformation mechanisms, including the primary {10 9 3}β type II high index deformation twins, secondary {332}β deformation twins, and α” martensite were identified. The deformation mechanism changes from primary deformation twins and α” martensite to multiple deformation mechanisms (primary and secondary deformation structure) with the increase of strain rates.

This study examined the literature on life cycle assessment on the ferromanganese alloy production route. The environmental impacts of raw material acquisition through the production of carbon reductants to the production of ferromanganese alloys were examined and compared. The transition from the current fossil fuel-based production to a more sustainable production route was reviewed. Besides the environmental impact, policy and socioeconomic impacts were considered due to evaluation course of differences in the production routes. Charcoal has the potential to substantially replace fossil fuel reductants in the upcoming decades. The environmental impact from current ferromanganese alloy production can be reduced by ≥20% by the charcoal produced in slow pyrolysis kilns, which can be further reduced by ≥50% for a sustainable production in high-efficient retorts. Certificated biomass can ensure a sustainable growth to avoid deforestation and acidification of the environment. Although gre... [more]

Manual generation of test cases and scenario screening processes, during field architecture concept development, may produce a limited number of solutions that do not necessarily lead to an optimal concept selection. For more complex subsea field architectures, which might include processing modules for enhancing pressure and thermal management for the production network, the number of configuration cases and scenarios to evaluate can be extremely large and time and resource-consuming to handle through conventional manual design processes. This paper explores the use of evolutionary algorithms (EA) to automate case generation, scenario screening, and optimization of decentralized subsea processing modules during field development. An evaluation of various genetic operators and evolution strategies was performed to compare their performance and suitability to the application. Based on the evaluation results, an EA using structural uniform crossover and a gradient plus boundary mutation... [more]

The absorption process of CO2 by ethanolamine solution is essentially a dynamic system, which is greatly affected by the power plant startup and flue gas load changes. Hence, studying the optimal control of the CO2 chemical capture process has always been an important part in academic fields. Model predictive control (MPC) is a very effective control strategy used for such process, but the most intractable problem is the lack of accurate and effective model. In this work, Aspen Plus and Aspen Plus Dynamics are used to establish the process of monoethanolamine (MEA) absorption of CO2 related models based on subspace identification. The nonlinear distribution of the system under steady-state operation is analyzed. Dynamic tests were carried out to understand the dynamic characteristics of the system under variable operating conditions. Systematic subspace identification on open-loop experimental data was performed. We designed a model predictive controller based on the identified model c... [more]

The heat transfer, friction factor, and collector efficiency are estimated experimentally for multi-walled carbon nanotubes+Fe3O4 hybrid nanofluid flows in a solar flat plate collector under thermosyphon circulation. The combined technique of in-situ growth and chemical coprecipitation was utilized to synthesize the multi-walled carbon nanotubes+Fe3O4 hybrid nanoparticles. The experiments were carried out at volume flow rates from 0.1 to 0.75 L/min and various concentrations from 0.05% to 0.3%. The viscosity and thermal conductivity of the hybrid nanofluids were experimentally measured at different temperatures and concentrations. Due to the improved thermophysical properties of the hybrid nanofluids, the collector achieved better thermal efficiency. Results show that the maximum thermal conductivity and viscosity enhancements are 28.46% and 50.4% at 0.3% volume concentration and 60 °C compared to water data. The Nusselt number, heat transfer coefficient, and friction factor are augmen... [more]

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA−PVS−Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA−PVS−Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01−0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses e... [more]

Biobutanol can be produced by Clostridia via an acetone−butanol−ethanol (ABE) fermentation under strictly anaerobic conditions. Oxygen-free nitrogen (OFN) gas is typically used to create anaerobic conditions for ABE fermentations. However, this method is not appropriate for large-scale fermentations as it is quite costly. The aim of this work was to study the feasibility of butanol production from sweet sorghum juice (SSJ) by Clostridium beijerinckii TISTR 1461 using various methods to create anaerobic conditions, i.e., growth of a strictly aerobic bacterium, an Arthrobacter sp., under different conditions and a chemical method using sodium dithionite (SDTN) to consume residual oxygen. SSJ containing 60 g/L of total sugar supplemented with 1.27 g/L of (NH4)2SO4 was used as a substrate for butanol production. The results showed that 0.25 mM SDTN could create anaerobic conditions, but in this case, C.beijerinckii TISTR 1461 could produce butanol at a concentration (PB) of only 8.51 g/L w... [more]

Hair follicles harbor a heterogeneous regenerative cell pool and represent a putative low-to-non-invasively available source of stem cells. We previously reported a technology for culturing human melanocytes from the hair follicle outer root sheath (ORS) for autologous pigmentation of tissue engineered skin equivalents. This study translated the ORS technology to horses. We de-veloped a culture of equine melanocytes from the ORS (eMORS) from equine forelock hair follicles cultured by means of an analogue human hair follicle-based in vitro methodology. The procedure was adjusted to equine physiology by addition of equine serum to the culture medium. The hair follicles were isolated by macerating forelock skin rests, enzymatically digested and subjected to air-medium-interface cultivation method. The procedure resulted in differentiated equine melanocytes, which exhibited typical morphology, presence of melanosomes, expression of cytoskeleton proteins vimentin, α-SMA, Sox2, S100ß and tyr... [more]

Alpha-lipoic acid (ALA, thioctic acid), a naturally-occurring essential dithiol compound, has become a common ingredient in many pharmaceutical and food supplement products (FSP), used in oxidative stress-dependent pathologies; oral bioavailability of ALA is limited by pharmacokinetic particularities that reduce its therapeutic efficacy-reduced solubility, lack of gastric stability and hepatic degradation, doubled by formulation hinders. The objectives were to develop a solid oral 600 mg ALA FSP to obtain an optimal pharmaceutical profile compared to a reference listed drug (RLD) with a similarity factor f2 50. A comparative dissolution study was performed; an HPLC method was used for ALA quantification. After planning combinatory simulations (formulation stage), two prototype formulas (#1 and #2) were manufactured and further optimized by adjusting ALA physical characteristics and the excipients quantities (#3 and #4) in order to achieve the Quality Target Product Profile. A misshapen... [more]

The main objective of this study is the synthesis, use, and reuse of magnetic copper ferrite nanospheres (CFNS) for extra-heavy oil viscosity reduction. The CFNS were synthesized using a solvothermal method resulting in mean particle size of 150 nm. Interactions of CFNS with the crude oil were evaluated through asphaltene adsorption isotherms, as well as static and dynamic rheology measurements for two cycles at 25 °C. Adsorption and desorption experiments corroborated that most of the asphaltenes adsorbed can be removed for nanoparticle reuse. During the rheology tests, nanoparticles were evaluated in the first cycle at different concentrations from 300 to 1500 mg/L, leading to the highest degree of viscosity reduction of 18% at 500 mg/L. SiO2 nanoparticles were evaluated for comparison issues, obtaining similar results regarding the viscosity reduction. After measurements, the CFNS were removed with a magnet, washed with toluene, and further dried for the second cycle of viscosity re... [more]

In order to exploit a fast-growing Paulownia hardwood as an energy crop, a xylose-enriched hydrolysate was obtained in this work to increase the ethanol concentration using the hemicellulosic fraction, besides the already widely studied cellulosic fraction. For that, Paulownia elongata x fortunei was submitted to autohydrolysis treatment (210 °C or S0 of 4.08) for the xylan solubilization, mainly as xylooligosaccharides. Afterwards, sequential stages of acid hydrolysis, concentration, and detoxification were evaluated to obtain fermentable sugars. Thus, detoxified and non-detoxified hydrolysates (diluted or not) were fermented for ethanol production using a natural xylose-consuming yeast, Scheffersomyces stipitis CECT 1922, and an industrial Saccharomyces cerevisiae MEC1133 strain, metabolic engineered strain with the xylose reductase/xylitol dehydrogenase pathway. Results from fermentation assays showed that the engineered S. cerevisiae strain produced up to 14.2 g/L of ethanol (corre... [more]

Diesel fuel mixtures with high concentrations of biodiesel have been investigated to analyze the technical feasibility of their use in diesel cycle engines regarding thermal and oxidative properties. The results of combined techniques of oxidative stability, high Pressurized Differential Scanning Calorimetry (P-DSC), Calculated Cetane Index (CCI), and calorific power were used to verify the effect of the thermal-oxidative stability as a function of the percentage of biodiesel in the mixtures. The obtained results evidenced that the thermal and oxidative stability decreased with the addition of biodiesel from 50 to 5% v/v. Low stability fuels require rapid use as the oxidation compounds degrade the product and impair vehicle performance, as well as lead to corrosion and clogging problems in various mechanical systems.

Continuous manufacturing opens up new operation windows with improved product quality in contrast to documented lot deviations in batch or fed-batch operations. A more sophisticated process control strategy is needed to adjust operation parameters and keep product quality constant during long-term operations. In the present study, the applicability of a combination of spectroscopic methods was evaluated to enable Advanced Process Control (APC) in continuous manufacturing by Process Analytical Technology (PAT). In upstream processing (USP) and aqueous two-phase extraction (ATPE), Raman-, Fourier-transformed infrared (FTIR), fluorescence- and ultraviolet/visible- (UV/Vis) spectroscopy have been successfully applied for titer and purity prediction. Raman spectroscopy was the most versatile and robust method in USP, ATPE, and precipitation and is therefore recommended as primary PAT. In later process stages, the combination of UV/Vis and fluorescence spectroscopy was able to overcome diffi... [more]

This study deals with wave-induced unsteady pressure on a ship moving with a constant forward speed in regular head waves. Two different numerical methods are applied to solve wave−ship interaction problems: a Rankine panel method which adopts velocity potential, and a Cartesian-grid method which solves the momentum and mass conservation equations under the assumption of inviscid and incompressible fluids. Before comparing l1ocal pressure distributions, the computational methods are validated for global quantities, such as ship motion responses and added resistance, by comparison with available experimental data. Then, the computational results and experimental data are compared for hydrodynamic pressure, particularly focusing on the magnitude of the first-harmonic component in different sections and vertical locations. Furthermore, the Cartesian-grid method is used to simulate the various wave-amplitude conditions, and the characteristics of the zeroth-, first-, and second-harmonic co... [more]