The pore space of autoclaved aerated concretes (ACCs), regardless of their apparent density, is represented by large pores formed as a result of gas formation and fine capillary pores. With the free absorption of liquid moisture, only the capillary pores are filled. Large pores contain vapor-air mixture. Considering such a bimodal pore size distribution, it is proposed to determine the thermal conductivity of moist ACC in two stages. First, an inhomogeneous ternary system that consists of a solid skeleton with a fine porous structure containing gas and liquid moisture should be considered. Then a binary system is taken into account, the first component of which is the mentioned ternary system, and the other component of which consists of isolated gas inclusions in large pores. To determine the thermal conductivity of the ternary system, the dependences constructed using the theory of generalized conductivity were used. The thermal conductivity of the binary system was calculated using... [more]

This article describes an approach for comparing material intensity values for residential buildings with different construction types. Based on the working drawings of the different construction types (wood and mineral), material intensities are calculated at the building level. Material intensities describe the materials used in a building in mass (tonnes (t)) in relation to the square meters (m2) of gross floor area (GFA) or the cubic meters (m3) of gross volume (GV). The method for determining material intensities at the building level is demonstrated. The results show that material intensities range from 0.61 t/m2 GFA to 1.95 t/m2 GFA for single-family residential buildings and from 1.36 t/m2 GFA to 1.54 t/m2 GFA for multi-storey residential buildings. The average material intensity for mineral buildings is twice as high as that for wood buildings, which means that there is a beneficial resource efficiency in building with wood instead of mineral materials. Therefore, benchmarks f... [more]

Transportation and portable applications already use hydrogen as fuel, but it is essential to use highly-efficient hydrogen storage methods to increase its usage in the future. The compressed form is the most utilized for transportation applications, but mechanical compressors have low efficiency when compressing low quantities of gas to high pressure. The most suitable device for hydrogen compression is the Electrochemical Hydrogen Compressor (EHC). It has the same structure as a Proton Exchange Membrane Fuel Cell (PEM-FC), but it works at very high-pressure ( 700 bar). The present work analyses the monopolar plate of an Electrochemical Hydrogen Compressor prone to hydrogen embrittlement. Irregular shape variations generate peaks of stress magnitude and triaxiality, further contributing to decreasing metal ductility at the local scale. The calculation of the stress field in such components is essential due to the possibility of failure due to the material embrittlement caused by hydro... [more]

Carbonate reservoirs commonly have significant heterogeneity and complex pore systems due to the multi-scale characteristic. Therefore, it is quite challenging to predict the petrophysical properties of such reservoirs based on restricted experimental data. In order to study the heterogeneity and size of the representative elementary volume (REV) of vuggy dolostones, a total of 26 samples with pore sizes ranging from micrometers to centimeters were collected from the Cambrian Xiaoerbulake Formation at the Kalping uplift in the Tarim Basin of northwestern China. In terms of the distribution of pore size and contribution of pores to porosity obtained by medical computed tomography testing, four types of pore systems (Types I−IV) were identified. The heterogeneity of carbonate reservoirs was further quantitatively evaluated by calculating the parameters of pore structure, heterogeneity, and porosity cyclicity. The results indicate that different pore systems yield variable porosities, por... [more]

The complex temperature and pressure conditions of deepwater wells have a serious impact on cementing quality. Therefore, the integrity of the cement seal becomes a critical factor that can restrict the safety of the wellbore, especially for wells ranging from the conventional deep water to deep water with more prominent deep stratum problems. The operating conditions of deep wells in deep water (referred as the dual-deep well) are complex and harsh. For the conventional evaluation device, it is difficult to accurately simulate the alternating HTHP conditions and to clarify the location and situation of the cement sheath leakage, which directly leads to the deviation of the evaluation results from the engineering reality. To solve this defect, based on the condition and structure characteristics of dual-deep wells, a device and method for casing/cement sheath/formation seal integrity evaluation for dual-deep wells at HTHP has been developed and established. Combined with the analysis o... [more]

Progress in science and technology drives the continuous innovation of energy collection and utilization. In the field of sports, the information collection and analysis based on Internet of things have attracted particular attention. Moreover, triboelectric nanogenerator (TENG) has promising applications in the field of sports. Here, we introduce the working principle of the TENG then the progress of the TENG as a wearable energy sensor is examined in the two fields of basic human activities and sports, especially competitive sports. On this basis, it is considered that the stability of devices, the universality of materials, and the scientificity of application of the TENG in the future need to be improved. We provide a direction for further upgrading energy collection technology to promote the high-quality development of human mechanical energy sensing in the field of sports.

Pineapple production around the world creates large amounts of wasted organic residue, mainly in the form of pineapple leaves. Current management practices consist of in situ decomposition or in situ burning, both of which cause the proliferation of flies and air pollution, respectively. The research conducted aims to develop a utilization process for this residue. Considering that pineapple leaves are rich in carbohydrates and other nutrients, a simple biological process involving a two-step procedure for juice production and ethanol fermentation has been developed to convert the leaves into renewable fuel and spent yeasts for animal feed. The liquid fraction extracted from the leaves is used as the nutrients to culture yeast, Kluyveromyces marxianus, for ethanol and yeast protein production. In Costa Rica, one of the major pineapple-producing countries in the world, the studied process can produce 92,708 and 64,859 tons of bioethanol and spent yeast per year, respectively, from its 4... [more]

Alkali pretreatment is one of the chemical pretreatment technologies that has been examined on various types of lignocellulosic biomass. To gain a better insight into the effects of a potassium-based catalyst on pyrolysis behavior with different materials, potassium bicarbonate (KHCO3) and potassium nitrate (KNO3) were used as additives in this study. The experimental parameters which included particle size, heating rate, and additive loading were investigated. The results showed that adding potassium for both KHCO3 and KNO3 to feedstocks led to increase in biochar. A model-free method, Flynn−Wall−Ozawa (FWO), was implemented in this study to determine the activation energy values for untreated and potassium-treated feedstocks. A reduction in apparent activation energy values of treated biomass was observed. This indicates that adding potassium salt to biomass influenced the structures of the main components and promoted the catalytic effect of pyrolysis. Activation energies of treated... [more]

The wide use of energy-efficient district heating systems allows for decreased atmospheric pollution resulting from lower emissions. One of the ways to increase the efficiency of existing district heating systems, and a key element of new systems using renewable energy sources, is modern heat storage technology—the utilization of dispersed PCM heat accumulators. However, the use of different solutions and the inconsistency of selection methods make it difficult to compare the obtained results. Therefore, in this paper, using TRNSYS software, a standardization of the selection of dispersed PCM heat accumulators for cooperation with buildings in the DHS was proposed along with a Life Cycle Assessment. Life Cycle Assessment could be a good, versatile indicator for new developments in district heating systems. A new contribution to the research topic was the Life Cycle Assessment itself as well as the range of heat output of the substations up to 2000 kW and the development of nomograms an... [more]

A simple semi-empirical gas-dynamic approach for measuring the instantaneous mass flow rate of gasification products of low-melting solid material (polypropylene) in a flow-through gas generator with ambient-temperature air as gasifying agent is proposed. The approach is validated experimentally in the direct-connect facility allowing for the short-term (~0.5 s) heating of incoming air up to ~1700 K by hydrogen injection and ignition or by pyrotechnic charge activation. The application of the proposed method for processing experimental data for 9 (of over 100) selected typical test fires showed that the time-averaged total yield of polypropylene gasification products varied from 43 to 120 g/s, while the air-to-gasification product mass ratio was 2.3−2.9. The results of all conducted experiments confirm the applicability of the proposed approach for determining the mass flow rate of gasification products. The universality of the proposed approach is confirmed by applying two different s... [more]

The article presents the results of research on the production of polymer-bitumen binder (PBB) based on mixtures of non-oxidized and oxidized petroleum products, namely high-viscosity tar, darkened vacuum distillate, and oxidized petroleum bitumen 70/100, obtained at technological installations of Limited Liability Partnership (LLP) “JV Caspi Bitum’’ and styrene-butadiene-styrene (SBS) block copolymer brand L 30-01A modifier in the presence of a stabilizer. The results obtained show that the introduction of the SBS modifier in the presence of a sulfur stabilizer improves the performance characteristics of PBB, such as elasticity, ductility, softening temperature, penetration, and brittleness temperature.

A study on the catalytic oxidation of heavy residual oil (HRO) was carried out. The thermodynamic parameters of components of HRO oxidation products were studied by pulsed nuclear magnetic resonance (NMR). A method for the quantitative assessment of thermodynamic parameters of HRO components and oxidized bitumen using pulsed NMR is presented. The relationship between NMR parameters and the viscosity of HRO and its oxidation products is established. The obtained results prove the possibility of using pulsed NMR as a flow-line method for rapid analysis of intermediates and products of the heavy residual oil oxidation.

Kenaf (Hibiscus Cannabinus) fibers have received significant attention for replacing the usage of synthetic fibers, especially glass fiber, in the fabrication of fiber-reinforced polymer (FRP) composites. The aim of this research was to study the change in wear behavior of kenaf-epoxy fiber composites by filling them with multiwall carbon nanotubes (MWCNT). In particular, the effect of untreated MWCNT (PMWCNT), acid-treated MWCNT (AMWCNT), and silane-treated MWCNT (SMWCNT) was studied, using three different MWCNT loadings, i.e., 0.5, 0.75, and 1 wt.%. The abrasive wear test was conducted to measure the wear properties of the composites. A thermal infrared camera was also used to measure the punctual contact temperature during the abrasive wear test, while the abraded surfaces were analyzed using the stereomicroscope. Starting from the considerable reduction of wear rate with the introduction of kenaf fibers, it was observed that PMWCNT provided some further, yet modest, reduction of we... [more]

The mechanical response and deformation mechanisms of TB17 titanium alloy were studied at room temperature by the split-Hopkinson pressure bar test. The ultimate compression strength increases from 1050 MPa to 1400 MPa, as the strain rate increases from 2000 s−1 to 2800 s−1. The adiabatic shear failure occurred at strain rate 2800 s−1. When the strain rate was 2000 s−1, only {10 9 3}β type II high index deformation twins, a small number of α” martensite, and interfacial ω phase were detected. When the strain rate was 2400 s−1 and above, multiple deformation mechanisms, including the primary {10 9 3}β type II high index deformation twins, secondary {332}β deformation twins, and α” martensite were identified. The deformation mechanism changes from primary deformation twins and α” martensite to multiple deformation mechanisms (primary and secondary deformation structure) with the increase of strain rates.

The heat transfer, friction factor, and collector efficiency are estimated experimentally for multi-walled carbon nanotubes+Fe3O4 hybrid nanofluid flows in a solar flat plate collector under thermosyphon circulation. The combined technique of in-situ growth and chemical coprecipitation was utilized to synthesize the multi-walled carbon nanotubes+Fe3O4 hybrid nanoparticles. The experiments were carried out at volume flow rates from 0.1 to 0.75 L/min and various concentrations from 0.05% to 0.3%. The viscosity and thermal conductivity of the hybrid nanofluids were experimentally measured at different temperatures and concentrations. Due to the improved thermophysical properties of the hybrid nanofluids, the collector achieved better thermal efficiency. Results show that the maximum thermal conductivity and viscosity enhancements are 28.46% and 50.4% at 0.3% volume concentration and 60 °C compared to water data. The Nusselt number, heat transfer coefficient, and friction factor are augmen... [more]

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA−PVS−Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA−PVS−Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01−0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses e... [more]

The main objective of this study is the synthesis, use, and reuse of magnetic copper ferrite nanospheres (CFNS) for extra-heavy oil viscosity reduction. The CFNS were synthesized using a solvothermal method resulting in mean particle size of 150 nm. Interactions of CFNS with the crude oil were evaluated through asphaltene adsorption isotherms, as well as static and dynamic rheology measurements for two cycles at 25 °C. Adsorption and desorption experiments corroborated that most of the asphaltenes adsorbed can be removed for nanoparticle reuse. During the rheology tests, nanoparticles were evaluated in the first cycle at different concentrations from 300 to 1500 mg/L, leading to the highest degree of viscosity reduction of 18% at 500 mg/L. SiO2 nanoparticles were evaluated for comparison issues, obtaining similar results regarding the viscosity reduction. After measurements, the CFNS were removed with a magnet, washed with toluene, and further dried for the second cycle of viscosity re... [more]

Fundamental studies involving divalent ion intercalated graphene-based hydrogel are still lacking in terms of their adsorption behavior towards dye pollutants. In this study, we prepared a self-assembled Mg2+ and Ca2+ intercalated reduced graphene hydrogel (rGH) using hydrothermal treatment to evaluate the intercalation impact on the adsorption capability towards cationic dyes, methylene blue and rhodamine B. The morphological, structural, thermal, and textural properties of the divalent ion intercalated reduced graphene hydrogels were studied using Fourier transform infrared spectrometer, thermogravimetric analysis, Raman spectroscopy, scanning electron microscope-energy dispersive spectroscopy, X-ray photoelectron spectroscopy, Brunauer−Emmett−Teller surface area analysis, and X-ray diffraction. The increased adsorption capacity of the divalent ion intercalated reduced graphene-based hydrogels towards the dye molecules resulted from the increase in the specific surface area and pore... [more]

A cost-effective and environmentally friendly method was formulated for rapid dopamine (DA) detection that was based on the fluorescence (FL) quenching of carbon quantum dots (C-dots). Upon adding DA to the C-dots’ solution, we noticed a regular reduction in their fluorescence intensity. The effects of pH, amount of C-dots, reaction temperature and time on the determination of DA were investigated. Under the optimized experimental conditions, trace amounts of DA could be analyzed. Furthermore, dopamine hydrochloride injection and human urine samples with and without spiked DA were analyzed using the developed sensing system. The procedure was validated following the guidelines of the European Medicines Agency (EMA) in terms of the following: calibration range (0.3−100 μM), linearity (R2 = 0.9991), limit of detection (LOD) (93 nM). Recoveries of dopamine with spiked samples at three different levels were between 95.0 and 105.9%, and the relative standard deviations (RSDs) were within 2.... [more]

The aim of this study was to find out what kind of “Bianca” wine could be produced when using organic yeast, what are the dynamics of the resulting alcoholic fermentation, and whether this method is suitable for industrial production as well. Due to the stricter rules and regulations, as well as the limited amount and selection of the permitted chemicals, resistant, also known as interspecific or innovative grape varieties, can be the ideal basic materials of alternative cultivation technologies. Well-designed analytical and organoleptic results have to provide the scientific background of resistant varieties, as these cultivars and their environmentally friendly cultivation techniques could be the raw materials of the future. The role of the yeast in wine production is crucial. We fermented wines from the “Bianca” juice samples three times where model chemical solutions were applied. In our research, we aimed to find out how organic yeast influenced the biogenic amine formation of thr... [more]

The Sogunjung decoction (SGJD) is a traditional herbal formula that has been used to treat constipation and improve the constitution of infirm children in Korea. In this study, simultaneous quantification of gallic acid (1), magnoflorine (2), albiflorin (3), paeoniflorin (4), liquiritin apioside (5), liquiritin (6), liquiritigenin (7), coumarin (8), cinnamaldehyde (9), benzoylpaeoniflorin (10), and glycyrrhizin (11) was conducted using fast and sensitive liquid chromatography−tandem mass spectrometry (LC−MS) multiple-reaction monitoring to develop a quality-control protocol for the SGJD. A Waters Acquity UPLC BEH C18 column (2.1 × 100 mm, 1.7 μm) was used for the chromatographic separation of the 11 marker compounds in the SGJD using two mobile phases (5 mM ammonium acetate in distilled water containing 0.1% (v/v) formic acid, and acetonitrile). The MS parameters for a simultaneous analysis were capillary voltage (3.0 kV), source temperature (150 °C), desolvation temperature (500 °C),... [more]

In Switzerland, waste wood fly ash (WWFA) must be treated before deposition on landfills due to its high pollutant load (Cr(VI) and heavy metals). Acid fly ash leaching, the process used for heavy metal recovery from municipal solid waste incineration fly ash (MSWIFA), represents a possible treatment for heavy metal depletion and Cr(VI) reduction in WWFA. The co-processing of WWFA with MSWIFA during acid fly ash leaching was investigated in laboratory- and industrial-scale experiments with different setups. Of interest were the effects on heavy metal recovery efficiency, the successful outcome of Cr(VI) reduction and consumption of neutralizing chemicals (HCl, H2O2). Detailed chemical and mineralogical characterization of two WWFA types and MSWIFA showed that MSWIFA has higher concentrations in potentially harmful elements than WWFA. However, both WWFA types showed high concentrations in Pb and Cr(VI), and therefore need treatment prior to deposition. Depending on the waste wood propor... [more]

To initiate our research into the development of biocompatiîle gelled-microemulsions based on essential oils (EOs) and sucrose esters (SEs) for the topical delivery of fluconazole, this formulation study investigated the usefulness of two relatively harmless natural non-ionic surfactants from the group of SEs (sucrose laurate and stearate) to form, in the presence of antifungal EOs, stable, isotropic microemulsions effective on fluconazole solubilization. Fluconazole’s solubility in EO significantly depended on their chemical composition, showing higher values for cinnamon, oregano and clove essential oils, further selected as oil phase components for microemulsion formulations. The phase behavior of several EO−isopropyl miristate/SE−isopropanol/water systems was assessed through pseudo-ternary phase diagrams constructed by microplate dilution technique. The hydrocarbon chain length of the SE and EO type strongly influenced the size of the microemulsion region in the pseudo-ternary pha... [more]

Sodium alginate (Na-Alg) is water-soluble, neutral, and linear polysaccharide. It is the derivative of alginic acid which comprises 1,4-β-d-mannuronic (M) and α-l-guluronic (G) acids and has the chemical formula (NaC6H7O6). It shows water-soluble, non-toxic, biocompatible, biodegradable, and non-immunogenic properties. It had been used for various biomedical applications, among which the most promising are drug delivery, gene delivery, wound dressing, and wound healing. For different biomedical applications, it is used in different forms with the help of new techniques. That is the reason it had been blended with different polymers. In this review article, we present a comprehensive overview of the combinations of sodium alginate with natural and synthetic polymers and their biomedical applications involving delivery systems. All the scientific/technical issues have been addressed, and we have highlighted the recent advancements.

The administration of drugs via transdermal therapeutic systems has become an attractive form of therapeutic approach, considering its advantages and the high patient compliance achieved, making them a viable alternative, especially in the treatment of chronic diseases. The purpose of our study was the development of polymer-based films containing tenoxicam (TX) and the analysis of dissolution kinetics. Auxiliary substances represent an important part of pharmaceutical forms, so during the first stage, TX and excipient compatibility were verified. Fourier Transform Infrared Spectroscopy (FT-IR) and Differential Scanning Calorimetry (DSC) analyses were performed on TX and on physical mixtures of TX-HPMCE5 and TX-HPMC15kcP. Three polymeric films of TX (TX1, TX2, and TX3) were prepared using a solvent evaporation technique. Release studies were done at 32 °C ± 1 °C with a Franz diffusion cell. The results of the DSC and FT-IR analyses demonstrated the compatibility of the active substance... [more]